BAM File Format

A BAM file (*.bam) is the compressed binary version of a SAM file that is used to represent aligned sequences. SAM and BAM formats are described in detail on the SAM Tools website: samtools.sourceforge.net.

BAM files contain a header section and an alignments section:

•

Header—Contains information about the entire file, such as sample name, sample length, and alignment method. Alignments in the alignments section are associated with specific information in the header section.
Alignment methods include banded Smith-Waterman, Burrows-Wheeler Aligner (BWA), and Bowtie. The term Isis indicates that an Illumina alignment method is in use, which is the banded Smith-Waterman method.

•

Alignments—Contains read name, read sequence, read quality, and custom tags.

M29:126:A0E89:1:4:10243:21066 64 ACADVL.NM_008658.6.7.6841396 26 40 25S10M * 0 0

TTGAGGGCTCGGTTAGACAGAAAGCGGCCACAGTC

@@CFFFFFDHH?CDG?FHBFFGGIIDHGIHIGIGI

RG:Z:HBR_100ng_35281_2 BC:Z:11 SM:i:40 NM:i:0 XN:Z:6841396

The read name includes the amplicon and start coordinate ACADVL.NM_008658.6.7.6841396 26, the alignment quality 40, and the match descriptor 25S10M * 0 0.

BAM index files (*.bam.bai) provide an index of the corresponding BAM file.


© 2015 Illumina, Inc. All rights reserved.	15067849 Rev. A