BAM Files

BAM files are written to Pair folder\Libraries in the Output Files.

A BAM file (*.bam) is the compressed binary version of a SAM file that is used to represent aligned sequences. SAM and BAM formats are described in detail at samtools.github.io/hts-specs/SAMv1.pdf.

BAM files use the file naming format of SampleName_S#.bam, where # is the sample number determined by the order that samples are listed in the sample sheet.

BAM files contain a header section and an alignments section:

}

Header—Contains information about the entire file, such as sample name, sample length, and alignment method.
The term Isis indicates that an Illumina alignment method is in use, which is the banded Smith-Waterman method.

}

Alignments—Contains read name, read sequence, read quality, alignment information, and custom tags.

GA23_40:8:1:10271:11781 64 chr22 17552189 8 35M * 0 0

TACAGACATCCACCACCACACCCAGCTAATTTTTG

IIIII>FA?C::B=:GGGB>GGGEGIIIHI3EEE#

BC:Z:ATCACG XD:Z:55 SM:I:8

The read GA23_40:8:1:10271:11781 maps to the chromosome 22 (chr22) at position 17552189, with alignment quality 8, and match descriptor CIGAR string 35M.

BAM files are suitable for viewing with an external viewer such as IGV or the UCSC Genome Browser.

BAM index files (*.bam.bai) provide an index of the corresponding BAM file.


© 2015 Illumina, Inc. All rights reserved.	Document # 1000000001133 v01