File Format

Each entry in a FASTQ file consists of 4 lines:

Sequence identifier
Sequence
Quality score identifier line (consisting only of a +)
Quality score

The first line, identifying the sequence, contains the following elements.

@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos>:<UMI> <read>:<is filtered>:<control number>:<index>

Table 1   FASTQ File Elements

Element

Requirements

Description

@

@

Each sequence identifier line starts with @.

<instrument>

Characters allowed:

a–z, A–Z, 0–9 and underscore

Instrument ID.

<run number>

Numerical

Run number on instrument.

<flowcell ID>

Characters allowed:

a–z, A–Z, 0–9

 

<lane>

Numerical

Lane number.

<tile>

Numerical

Tile number.

<x_pos>

Numerical

X coordinate of cluster.

<y_pos>

Numerical

Y coordinate of cluster.

<UMI>

Restricted characters: A/T/G/C/N

Optional, appears when UMI is specified in sample sheet. UMI sequences for Read 1 and Read 2, seperated by a plus [+].

<read>

Numerical

Read number. 1 can be single read or Read 2 of paired-end.

<is filtered>

Y or N

Y if the read is filtered (did not pass), N otherwise.

<control number>

Numerical

0 when none of the control bits are on, otherwise it is an even number.

On HiSeq X and NextSeq systems, control specification is not performed and this number is always 0.

<index>

Restricted characters: A/T/G/C/N

Index of the read.

An example of a valid entry is as follows; note the space preceding the read number element:

@SIM:1:FCX:1:15:6329:1045:GATTACT+GTCTTAAC 1:N:0:ATCCGA

TCGCACTCAACGCCCTGCATATGACAAGACAGAATC

+

<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=