BCL Convert Compatible Products

Compatibility Between BCL Convert and bcl2fastq/bcl2fastq2

Adapter Settings
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim.

(Sample Sheet)

Adapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

OR

TrimAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

(Sample Sheet)

AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

AND

AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Designate the same adapter sequence for Read 1 and Read 2 and specify the behavior as mask.

(Sample Sheet)

MaskAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

(Sample Sheet) AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

AND

AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterBehavior, mask

Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as mask.

(Sample Sheet)

MaskAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

OR

MaskAdapterRead2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

(Sample Sheet)

AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

AND

AdapterRead2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

AND

AdapterBehavior, mask

Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim. Also specify 0.5 as the adapter stringency.

(Sample Sheet)

Adapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

OR

TrimAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (Command Line) --adapter-stringency 0.5

AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

AND

AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA(Sample Sheet) AND

AdapterStringency, 0.5

Read Trimming Settings
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Trim the first 7 bases and last 6 bases of Read 1 for a 151 x 8 x 8 x 151 run.

(Sample Sheet)

Read1StartFromCycle, 8 Read1EndWithCycle, 145

(Sample Sheet)

N7Y137N6;I8;I8;Y151

UMI Specifications
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Designate the first 8 cycles of Read 1 and Read 2 as UMIs and trim the trailing base for a 151 x 8 x 8 x 151 run.

(Sample Sheet)

Read1UMIStartFromCycle, 1

Read1UMILength, 8

Read1StartFromCycle, 10

Read2UMIStartFromCycle, 1

Read2UMILength, 8

Read2StartFromCycle, 10

(Sample Sheet)

U8N1Y142;I8;I8;U8N1Y142

Barcode Mismatches
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Allow 1 mismatch in the i7 index sequence and 1 mismatch i5 index sequence.

--barcode-mismatches 1

OR

--barcode-mismatches 1,1

BarcodeMismatchesIndex1, 1

AND

BarcodeMismatchesIndex2, 1

Allow 2 mismatches in the i7 index sequence and 2 mismatches in the i5 index sequence.

--barcode-mismatches 2

OR

--barcode-mismatches 2,2

BarcodeMismatchesIndex1, 2

AND

BarcodeMismatchesIndex2, 2

Masking of Trimmed Reads
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Allow 1 mismatch in the i7 index sequence and 1 mismatch i5 index sequence.

--barcode-mismatches 1

OR

--barcode-mismatches 1,1

BarcodeMismatchesIndex1, 1

AND

BarcodeMismatchesIndex2, 1

Allow 2 mismatches in the i7 index sequence and 2 mismatches in the i5 index sequence.

--barcode-mismatches 2

OR

--barcode-mismatches 2,2

BarcodeMismatchesIndex1, 2

AND

BarcodeMismatchesIndex2, 2

Sample Project Settings
Behavior Obsolete bcl2fastq/bcl2fastq2 Setting New BCL Convert Setting
Output corresponding fastq files to specific subdirectories.

(Sample Sheet) – [Data] section Sample_Project ,

(Sample Sheet) – [Data] or [BCLConvert_Data] section Sample_Project , …

(Command Line) --bcl-sampleproject-subdirectories true